Gene expression in the tree shrew (Tupaia belangeri) hippocampus


Web appendix

If you happen to find any errors, typos, broken links, we'll appreciate if you take the time to write us a few lines. Thanks.


Appendix to Methods

Following is the list of all the primer sequences used to perform Real Time quantitative RT-PCR, as explained in the paper.

Primer   Sequence  
BDNF F TAAATGAAGTTTATACAGTACAGTGGTTCTACA
BDNF R AGTTGTGCGCAAATGACTGTTT
Calcium ATPase F GCATGCTCCTCCTTCAGAACAT
Calcium ATPase R AATTTTCCGGGCATTTATTTCA
CLK-1 F   (*) GATGAACACAGTTCTGCTGGCA
CLK-1 R   (*) TTCAGTATCCTGGGAAAGCATGA
CLK-1 F   (*) GAAAGCATGAATTCCTTTAGAGGTTTAC
CLK-1 R   (*) CGACTAGACTGGGATGAACACAGTT
c-02o6 F AACCCATTTTCTCTGAGTAATTCATTGT
c-02o6 R GCTGGTCTTCTGGATTGTTACTTATTTAAT
survival of motor neuron F TCTGAAGTGAAGCTCTTAGTGGACA
survival of motor neuron R GCTAACCAAGCAGATTAATAAATTCAAA
hsp 90 F CAGTGATGATGAGGCAGAGGAA
hsp 90 R CTTCAATCTTGGGCTTCTCTTCA
cyclophilin F CAAATGCTGGACCCAACACA
cyclophilin R TGCCATCCAACCACTCAGTCT
60 s prot L44 F TGGATCACCTGGCCCTTTC
60 s prot L44 R GGATGCTGGCCATTAAAAGATG
c-02o8 F GAGAAGGGCTACAAAGTCCTGAAT
c-02o8 R AGACGACCTATTTCAATTTATCTTAATCTCTA
c-02o8b.F AGAACGTCTTAGGCTGAGATGAATC
c-02o8b.R TTCAGCATTAGGCTGATCTTCAATATA
NGF F ACATCAAGGGCAAGGAGGTG
NGF R ACTTGGTCTCTACTGTTTGAATACACTGTT
Solute carrier family 25 (SLC25A3) F CCTCCACCTGAGATGCCAGA
Solute carrier family 25 (SLC25A3) R GATTCAGTCCACATTTGCTTTGAT
Multifunctional protein ADE2 F ATGAGGGAAAAACGAAAGAAGTCTAT
Multifunctional protein ADE2 R CGCTGTAATCTGGTCCTTGGA
Protein phosphatase 1 (PPP1CB) F AAGCACCCAATACCTACAGTTGACA
Protein phosphatase 1 (PPP1CB) R TTTTCTCCCTCTGTTCGAAGGAT
CalmodulinF TGTCATTGTCCTGAGACCTTATTTTAGA
CalmodulinR AGTTTAGATGTGCAGAAGGGCTTAGA
Potassium channel (KCNJ13) TTGAAGCAATAGTCCGGTTTCAA
Potassium channel (KCNJ13) CAGTTTTATGAGGATGTTCACTGAATGT
c-07b12 F TCTGGGTCTAGGACTCTTAATTGCA
c-07b12 R CAGCTGGCAAATGGTAATTAAGAA
smad interacting GGATCATTGACACGGCACTACA
smad interacting TCCCTGAGTATGCATTGACTTGATA
Contig 202 F TTTCCAGTCTATTCATGACATTCAACA
Contig 202 R TTCAAAAGTAAATCAATCCCCTAGAAGT
Contig 251 F CTGCCAGTGTCTTTATTAGTGGTCAA
Contig 251 R GCCTATTTGGAGTTCCCTCTTCTA
mGluR2 F CCTGCTGGGTGGCGTCT
mGluR2 R TGGACGGCTTGGCGAT
m6a F ATTAATGGAAGCCTTTTCAAATATATCAT
m6a R CTAACCCCTCAGAAGTTGTTTTACCTA
Contig 282 F CACAAAGAAAGGCTGAGCTACTGAT
Contig 282 R TTGAGTCACATTGATTTCAGCAGA
Contig 257 F TGTTGGAGCAGATGTATTGGATTTA
Contig 257 R CACTCTTTTTGCTGTGGTGAAAGAT
Contig 217 F AAGAAACGAGCAAAACAATGTGTTAC
Contig 217 R AAGAGTCACCCAAGGAAAGAAAATT
Contig 138 F GGGTAATAATGGGACAAAAGCTTAGT
Contig 138 R TTGCATGATCTGCTCTCCCTTA
Contig 136 F TGGTCTGGATGTTGCAGCTAGA
Contig 136 R TTTCACTTCTCCCATTCCACACTA
Contig 114 F CAGACTGCATGCTTACCATAACATT
Contig 114 R TCGCAGTTTGCACACAATTGT
Contig 64 F TCTCCTTCCCATTCGCTCAT
Contig 64 R TGTTCTCCTTAATTTCTCTAATTCTCAAAG
t-06b11 F GATATAACTGCTCCCATTTTACAGATA
t-06b11 R GCATTCAAGTCTCAGAAGGGACTATGA
t-07g12 F TGAACATTATGAGCCTCAGTTGATATT
t-07g12 R AAACTTTAAGGAAAATTTGGCAATTCA
c-02h3 F CAGCTGGATTTAATTATACATGCCAAT
c-02h3 R GAGAGCCAAGGTCAAATTTAAG

(*) Expression of CLK-1 was measured using two different pairs of primers, showing similar results.


Sequence summaries

All sequences have been subjected to similarity searches against different databases. A summary of the results for each sequence is available.


Search for a specific clone

If you are looking for a specific clone or contig (e.g. clone 02o8, Contig304) use the form below. Note that if you're searching for a clone that happens to be a member of some contig, you will get directed to the page for that contig.

Enter the search term:   (Examples: 02o8, Contig22, 22, o8, etc.)


Search the dataset using BLAST

Enter your sequence (FASTA format or plain text):

Program:

  



Fernán Agüero, 26.Sep.2002 - 11:54:07 ART